This page uses modern technologies that don't seem to be supported by your browser. Please consider using a recent version of Mozilla Firefox, Google Chrome or Microsoft Edge. Apple Safari might also work (untested).

STRNaming: STR Sequence Name Generator

STRNaming is an unbiased method to automatically generate short, informative and human-readable descriptions of STR alleles that works the same for any locus in use now or in the future.

This page is based on STRNaming version 1.0.0. A new version (1.1.0) is coming soon. Please refer to STRNaming Updates for more information.

Reference sequences

The first step is to extract the core features of an STR locus from its reference sequence. These features are:

Please enter a single reference sequence per marker below. The CE length of the reference allele may be omitted. Hover the mouse pointer over an analysed sequence to see precisely what data was extracted from it.

Generally, input sequences should be in uppercase letters. Upstream and downstream sequence (outside of the region that is analysed by your PCR kit) may be provided in lowercase letters. These parts of the sequence will be taken into account when analysing the reference sequence, but should not be visible in the sequences entered in the 'Allele naming' section below.

Legend: MarkerName CElength PrefixRepeat1GapRepeat2Repeat1Repeat3Repeat4Repeat5Suffix

Toggle full width
D13S317 11 cgtgactctctggacTCTGACCCATCTAACGCCTATCTGTATTTACAAATACATTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCAATCAATCATCTATCTATCTTTCTGTCTGTCTTTTTGGGctgcctatggctcaa

Allele naming sequence input

Please enter the sequences to process below. Any lowercase portion of the reference sequence entered above should NOT be included here. Each line should contain a marker name and a sequence separated by a space, comma, or semicolon. If you need to reverse-complement some sequences, try this.

D13S317 TCTGACCCATCTAACGCCTATCTGTATTTACAAATACATTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCAATCATCTATCTATCTTTCTGTCTGTCTTTTTGGG

Allele name output

The resulting allele names are displayed below. Hover the mouse pointer over a name to see lower-scoring alternatives.

Additionally, the Sequence Identifier (SID) nomenclature is accessible. This nomenclature was independently developed by Young et al. and used with their permission. See: A nomenclature for sequence-based forensic DNA analysis. Forensic Sci Int Genet, 42, 14–20.




Toggle full width Copy to clipboard
Analyzing, please wait...