This page uses modern technologies that don't seem to be supported by your browser. Please consider using a recent version of Mozilla Firefox, Google Chrome or Microsoft Edge. Apple Safari might also work (untested).

STRNaming: STR Sequence Name Generator

STRNaming is an unbiased method to automatically generate short, informative and human-readable descriptions of STR alleles that works the same for any locus in use now or in the future.

This page is based on STRNaming version 1.2.0. Please refer to STRNaming Updates for more information regarding STRNaming versions and compatibility.

Reported Ranges

Please enter the names and genomic coordinates of the analysed sequence fragments. Coordinates are 1-based, using human genome reference sequence version 38 (GRCh38). Each line should contain a marker name and a coordinate range, in that order. Various formats are supported, such as "chr13:82148021-82148104", "13:82148021..82148104" or "Chromosome 13, from 82148021 to 82148104" or variations thereof. Coordinate ranges should exclude the primer binding sites. By default, the ISFG Minimum Range GRCh38 coordinates are used.

This online version of STRNaming is currently limited to the most commonly used forensic STR markers. If a message "Reference sequence unavailable" shows up for any of your markers, please contact us via email or GitHub to have them added! Alternatively, install FDSTools and use the 'seconvert' tool to access the Python version of STRNaming.

D1S1677 Chr1:163590022-163590097 D1S1656 Chr1:230769601-230769687 TPOX Chr2:1489647-1489692 D2S441 Chr2:68011943-68011999 D2S1776 Chr2:168788889-168788940 D2S1338 Chr2:218014855-218014954 D3S1358 Chr3:45540733-45540807 D3S4529 Chr3:85803473-85803538 D4S2408 Chr4:31302794-31302838 FGA Chr4:154587729-154587827 D5S2800 Chr5:59403126-59403203 D5S818 Chr5:123775548-123775603 CSF1PO Chr5:150076318-150076380 SE33 Chr6:88277125-88277281 D6S1043 Chr6:91740219-91740277 D6S474 Chr6:112557946-112558022 D7S820 Chr7:84160200-84160281 D8S1179 Chr8:124894859-124894922 D9S1122 Chr9:77073812-77073879 D10S1248 Chr10:129294239-129294299 TH01 Chr11:2171082-2171120 vWA Chr12:5983954-5984049 D12S391 Chr12:12297011-12297099 D12ATA63 Chr12:107928584-107928632 D13S317 Chr13:82148021-82148104 D14S1434 Chr14:94842050-94842110 Penta E Chr15:96831008-96831044 D16S539 Chr16:86352698-86352749 D17S1301 Chr17:74684851-74684906 D18S51 Chr18:63281663-63281756 D19S433 Chr19:29926212-29926303 D20S482 Chr20:4525688-4525754 D21S11 Chr21:19181969-19182105 Penta D Chr21:43636185-43636282 D22S1045 Chr22:37140283-37140341 DYS393 ChrY:3263107-3263163 DYS505 ChrY:3772786-3772843 DYS456 ChrY:4402915-4402983 DYS570 ChrY:6993186-6993264 DYS576 ChrY:7185314-7185394 DYS522 ChrY:7547580-7547629 DYS458 ChrY:7999831-7999907 DYS481 ChrY:8558328-8558409 DYS627 ChrY:8781940-8782077 DYS19 ChrY:9684374-9684447 DYS391 ChrY:11982085-11982142 DYS635 ChrY:12258854-12258955 DYS437 ChrY:12346263-12346332 DYS439 ChrY:12403512-12403570 DYS389I ChrY:12500439-12500499 DYS389II ChrY:12500439-12500618 DYS438 ChrY:12825885-12825953 DYS612 ChrY:13640724-13640839 DYS390 ChrY:15163061-15163170 DYS643 ChrY:15314128-15314194 DYS533 ChrY:16281342-16281400 Y-GATA-H4 ChrY:16631669-16631724 DYS385 b ChrY:18639700-18639784 DYS385 a ChrY:18680604-18680700 DYS461 ChrY:18888800-18888855 DYS460 ChrY:18888949-18888999 DYS549 ChrY:19358334-19358395 DYS392 ChrY:20471982-20472030 DYS448 ChrY:22218919-22219087 DYF387S1 fragment 1 ChrY:23785357-23785508 DYF387S1 fragment 2 ChrY:25884573-25884728 DXS10135 ChrX:9338298-9338420 DXS8378 ChrX:9402256-9402305 DXS7132 ChrX:65435641-65435709 DXS10074 ChrX:67757311-67757414 DXS10103 ChrX:134284955-134285044 HPRTB ChrX:134481488-134481565 DXS7423 ChrX:150542518-150542596

Allele naming sequence input

Please enter the sequences to process below. Each line should contain a marker name and a sequence separated by a space, comma, or semicolon. Sequence data should exclude the primers and should correspond exactly to the range entered above. If you need to reverse-complement some sequences, try this.

D13S317 ACATTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCAATCATCTATCTATCTTTCTGTCTGTCTTTTT

Allele name output

The resulting allele names are displayed below.

Toggle full width Copy to clipboard